Supplementary Figure

• Supplementary Figure 1 - Supplementary Figure 1. A. Expression of PEPCK and G6Pase in hepatic tissue did not change after treatment with bisphenol A (BPA). B. Expression of PFK and GS in skeletal muscles did not change after treatment with BPA. To evaluate the expression of PEPCK and G6Pase, total RNA was extracted from the liver, muscle, and white adipose tissue (WAT) using the RNeasy protocol (Qiagen, Hilden, Germany). One microgram of total RNA from each sample was reverse transcribed into complementary DNA in a volume of 20 μL with avian myeloma leukaemia virus reverse transcriptase and oligo-dT primers according to the manufacturer's manual. For polymerase chain reaction (PCR), the following primers were used: mouse PEPCK (131 base pairs), 5'- ATCATCTTTGGTGGCCGTAG -3' (forward) and 5'- ATCTTGCCCTTGTGTTCTGC -3' (reverse) ; mouse G6Pase (172 base pairs), 5'- TCTGTCCCGGATCTACCTTG -3' (forward) and 5'- GTAGAATCCAAGCGCGAAAC -3' (reverse); mouse PFK (158 base pairs), 5'- GGCGGAGGAGAGCTAAAACT -3' (forward) and 5'- ATACCAACTCGGACCACAGC -3' (reverse) and mouse GS (264 base pairs), 5'- TCCTCAGACCCCATCTTGAC -3' (forward) and 5'- CTCCATAAAGCAGCCAAAGC -3' (reverse). The reverse-transcription PCR program consisted of 1 cycle at 95°C with a 3-min hold followed by 30 cycles at 96°C with a 30-s hold, at 55°C with a 45-s hold, and at 72°C with a 45-s hold, followed by 1 cycle at 72°C with a 5-min hold. PCR fragments were separated on a 1.5% agarose gel containing ethidium bromide and were visualised by UV irradiation. GAPDH primer sequences were obtained from Clontech (Heidelberg, Germany) and were used as a positive control and a standard for gene expression quantification. Data are presented as mean ± SEM. (PDF 31 KB)